Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circTLK1 | |||
Gene | TLK1 | Organism | Human |
Genome Locus | Build | hg19 | |
Disease | Ischemic Stroke | ICD-10 | Cerebral infarction, unspecified (I63.9) |
DBLink | Link to database | PMID | 31311824 |
Experimental Method | |||
Sample Type | Plasma | Comparison | 70 paired non-tumorous tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ACAGTTTTGGAAGCTTGGGATCT ReverseTGCTCCCACTTGCAACTCCA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Wu, F, Han, B, Wu, S, Yang, L, Leng, S, Li, M, Liao, J, Wang, G, Ye, Q, Zhang, Y, Chen, H, Chen, X, Zhong, M, Xu, Y, Liu, Q, Zhang, JH, Yao, H (2019). Circular RNA TLK1 Aggravates Neuronal Injury and Neurological Deficits after Ischemic Stroke via miR-335-3p/TIPARP. J. Neurosci., 39, 37:7369-7393. |